View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_298 (Length: 244)
Name: NF9795A_low_298
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_298 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 3 - 220
Target Start/End: Original strand, 4054910 - 4055128
Alignment:
| Q |
3 |
gatgtcgaagaaaatgatgacccgacccaccgacccaataaccctattcggattttactttgtgtagacacttcgagagaaaaacacat-aaacacagtc |
101 |
Q |
| |
|
|||||| || |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
4054910 |
gatgtccaataaaacgatgacccgacccaccgacccaataaccctattcggatcttactttgtgtagacagttcgagagaaaaacacattaaacacagtg |
4055009 |
T |
|
| Q |
102 |
aaacttcgaaacaaagagtgtcttctgaaacaaattttgttttgtttaacgttggtgtttagaaagacatatcaatgttgttggggaagagaaacagaga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4055010 |
aaacttcgaaacaaagagtgtcttctgaaacaaattttgttttgtttaacgttggtgtttagaaagacatatcaatgttgttggggaagagaaacagaga |
4055109 |
T |
|
| Q |
202 |
aacaaagatattactgtta |
220 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
4055110 |
aacaaagatatcactgtta |
4055128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University