View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_299 (Length: 244)
Name: NF9795A_low_299
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_299 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 16 - 244
Target Start/End: Complemental strand, 6566400 - 6566172
Alignment:
| Q |
16 |
catcacaaggttcgtggtattttcccaattcctcatcatacacagaaagttgacttaatttatgtgtgttctcacccaagtatgatctattgatagaaat |
115 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6566400 |
catcacaaggttcgtgatattttcccaattcctcatcattcacagaaagttgacttaatttatgtgtgttctcacccaagtatgatctactgatagaaat |
6566301 |
T |
 |
| Q |
116 |
tagatcttccaaatgactttcaggatcaatatttgcactaccaagaggctttactgatccatcatcttgagatttctccatgactggcatattcgcttga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6566300 |
tagatcttccaaatgactttcaggatcaatatttgcactaccaagaggctttactgatccatcatcttgagatttctccatgactggcatattcgcttga |
6566201 |
T |
 |
| Q |
216 |
tccctcttttcatttttagggggtaagga |
244 |
Q |
| |
|
||||| ||||||||||||||| ||||||| |
|
|
| T |
6566200 |
tcccttttttcatttttagggagtaagga |
6566172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University