View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_313 (Length: 240)
Name: NF9795A_low_313
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_313 |
 | |
|
| [»] scaffold0015 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0015 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 2 - 240
Target Start/End: Complemental strand, 178482 - 178244
Alignment:
| Q |
2 |
agatggacatctccctttcaaatcggataatttccaccctatcgcttctttgttgaacttgaggatttccaccaactttgcttcttcagtgacggacaaa |
101 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
178482 |
agatggacatatccctttcaaatcggataatttccaccctatcgcttctttgttgaacttgaggatttccaccaactttgcttcttcagtgacggacaag |
178383 |
T |
|
| Q |
102 |
gagctactaatgatcaccggtttggtaccaccgtcttcaaggaacacatatttcaaatgtgatggtaaaactttcaattcaaccttggtgtcatcaactt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
178382 |
gagctactaatgatcaccggtttggtaccaccatcttcaaggaacacatatttcacatgtgatggtaaaactttcaattcaaccttggtgtcatcaactt |
178283 |
T |
|
| Q |
202 |
tggcttcttccttggagtcctctttcaactcttctagtt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
178282 |
tggcttcttccttggagtcctctttcaactcttctagtt |
178244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 23 - 232
Target Start/End: Complemental strand, 20172083 - 20171874
Alignment:
| Q |
23 |
atcggataatttccaccctatcgcttctttgttgaacttgaggatttccaccaactttgcttcttcagtgacggacaaagagctactaatgatcaccggt |
122 |
Q |
| |
|
|||||| || ||||| ||||| |||||||| || |||||||| ||| ||||| ||| ||| || |||||||||| |||||||||||| | |||||| |
|
|
| T |
20172083 |
atcggacaacttccaacctattgcttctttattactcttgaggacttcgaccaattttttttcctctttgacggacaaggagctactaatgttaaccggt |
20171984 |
T |
|
| Q |
123 |
ttggtaccaccgtcttcaaggaacacatatttcaaatgtgatggtaaaactttcaattcaaccttggtgtcatcaactttggcttcttccttggagtcct |
222 |
Q |
| |
|
||||||||| | | ||||| || || || ||||| ||||||||||| ||||| | ||||||||||| ||| ||||||||| |||||||||||| || | |
|
|
| T |
20171983 |
ttggtaccatcattttcaaaaaaaacgtacttcaagtgtgatggtaagacttttagttcaaccttggcatcaccaactttggattcttccttggactcat |
20171884 |
T |
|
| Q |
223 |
ctttcaactc |
232 |
Q |
| |
|
|||||||||| |
|
|
| T |
20171883 |
ctttcaactc |
20171874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 187
Target Start/End: Complemental strand, 17787590 - 17787509
Alignment:
| Q |
106 |
tactaatgatcaccggtttggtaccaccgtcttcaaggaacacatatttcaaatgtgatggtaaaactttcaattcaacctt |
187 |
Q |
| |
|
||||||||||||||||||| || ||| | ||||||||| | |||||||| | |||||| | ||||| |||| ||||||||| |
|
|
| T |
17787590 |
tactaatgatcaccggttttgtgccatcctcttcaaggcatacatattttagatgtgacgacaaaaccttcatttcaacctt |
17787509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University