View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_320 (Length: 239)
Name: NF9795A_low_320
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_320 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 24 - 239
Target Start/End: Complemental strand, 1734789 - 1734574
Alignment:
| Q |
24 |
acaaaagggatggggatggcagtgtagaaataaagaactctaggtatgaggatgatcgcaaagaaaggaagaactcaagggaagaggatgatcgcaaagt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1734789 |
acaaaagggatggggatggcagtgtagaaataaagaactctaggtatgaggatgatcgcaaagaaaggaagaactcaagggaagaggatgatcgcaaagt |
1734690 |
T |
 |
| Q |
124 |
aagaaggaactcaagggaagatgatgatcacagagagagaaagagctcaagggatgaggatgttcgtggggaaagaaagtacagaggggacgatgattat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1734689 |
aagaaggaactcaagggaagatgatgatcacagagagagaaagagctcaagggatgaggatgttcgtggggaaagaaagtacagaggggacgatgattat |
1734590 |
T |
 |
| Q |
224 |
catggagagagaaagc |
239 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
1734589 |
catggagagagaaagc |
1734574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University