View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_340 (Length: 235)
Name: NF9795A_low_340
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_340 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 33 - 213
Target Start/End: Original strand, 48142276 - 48142456
Alignment:
| Q |
33 |
cctttgatgagtgtcggcaccttatttattgttcctgtttacccaactttcactgtttaaattgattattatagttatggttatgatgannnnnnnnaac |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |
|
|
| T |
48142276 |
cctttgatgagtgtcggcaccttatttattgttcctgtttacccaactttcactgtttaaattgattattatagttatggttatgattattttttttaac |
48142375 |
T |
 |
| Q |
133 |
aaccccccgtttagggtacaactctaataatttgaagttttgtcagatgataactaaaatctgatcaatgttttaaccaga |
213 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48142376 |
aaccccccgtttaggggacaactctaataatttgaagttttgtcagatgataactaaaatctgatcaatgttttaaccaga |
48142456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 48142228 - 48142265
Alignment:
| Q |
1 |
gtgagactgggaattgtgtagggtctccctttcctttg |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48142228 |
gtgagactgggaattgtgtagggtctccctttcctttg |
48142265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University