View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_370 (Length: 230)
Name: NF9795A_low_370
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_370 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 31699265 - 31699036
Alignment:
| Q |
1 |
tcatccatagattgactagcacatctaaccaaaatggtttggttgaatataaatcgacaaatagtataaaagggtctaactctacttgcccatccctcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31699265 |
tcatccatagattgactagcacatctaaccaaaatggtttggttgaaaataaattgacaaatagtataaaagggtctaactctacttgcccatccctcct |
31699166 |
T |
 |
| Q |
101 |
ccataccgctttcctaatgggatttcagtttttacattgctgtatacctatcaacagactccgttcatctgcaatctaattatattccccatgccacact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31699165 |
ccataccgctttcctaatgggatttcagtttttgcattgctgtatacctatcaacagactccgttcatcagcaatctaattatattccccatgccacact |
31699066 |
T |
 |
| Q |
201 |
taataagttcctaccatacctcataacaag |
230 |
Q |
| |
|
||||||||||||||| |||||||||||||| |
|
|
| T |
31699065 |
taataagttcctaccctacctcataacaag |
31699036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University