View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_41 (Length: 409)
Name: NF9795A_low_41
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 16 - 390
Target Start/End: Original strand, 10452833 - 10453207
Alignment:
| Q |
16 |
catcagatctattttaagagaacttgatggatcagcttgtcggcagcacttttcattcttgaattgatcaagctcggcaattagcgcagacgcccacgag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10452833 |
catcagatctattttaagagaacttgatggatcagcttgtcggcagcacttttcattcttgaattgatcaagctcggcaattagcgcagacgcccacgag |
10452932 |
T |
|
| Q |
116 |
tcagaacaacttggttcacacctgttttctgaaccattcatcttgaggatatcccaatccaccgcagttagcctctccgtactgtccgactgactatctg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10452933 |
tcagaacaacttggttcacacctgttttctgaaccattcatcttgaggatatcacaatccaccgcagttagcctctccgtactgtccgactgactatctg |
10453032 |
T |
|
| Q |
216 |
tgagagattcaacgcaaaatgaggatgaagcaatggatttatgatcttttgaagctattgtctgcaatctccgacactcagactcaagcttggctacttt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10453033 |
tgagagattcaacgcaaaatgaggatgaagcaatggatttatgatcttttgaagctattgtcttcaatctccgacactcagactcaagcttggctacttt |
10453132 |
T |
|
| Q |
316 |
cttgatgctttctaaatgttgcttactagctgtctcggctgcttgggtgctcaaatccctctcaacagttctgat |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10453133 |
cttgatgctttctaaatgttgcttactagctgtctcggctgcttgggtgctcaaatccctctcaacagttctgat |
10453207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 290 - 378
Target Start/End: Original strand, 39573247 - 39573335
Alignment:
| Q |
290 |
cactcagactcaagcttggctactttcttgatgctttctaaatgttgcttactagctgtctcggctgcttgggtgctcaaatccctctc |
378 |
Q |
| |
|
||||||| |||||||| || || |||||| |||| || |||||||||||||||||||| || || ||||| || |||||||||||||| |
|
|
| T |
39573247 |
cactcagcttcaagcttagcaaccttcttggtgctctccaaatgttgcttactagctgtttcagcagcttgagtactcaaatccctctc |
39573335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University