View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_418 (Length: 224)
Name: NF9795A_low_418
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_418 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 6 - 204
Target Start/End: Complemental strand, 3429498 - 3429300
Alignment:
| Q |
6 |
aagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccacaactattactccctccttatggcacactccaatcccaca |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3429498 |
aagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccgcaactattactccctccttatggcacactccaatcccata |
3429399 |
T |
|
| Q |
106 |
tctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccacgatgg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3429398 |
tctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaagatgg |
3429300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 6 - 203
Target Start/End: Complemental strand, 3426019 - 3425822
Alignment:
| Q |
6 |
aagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccacaactattactccctccttatggcacactccaatcccaca |
105 |
Q |
| |
|
||||||||||||||| ||||||||||| | |||||||||||||||| |||| |||||| ||||||||| ||| ||||||||||||||||||||| ||| | |
|
|
| T |
3426019 |
aagacaaaatgaggagtatacccaccaaattgctaaacacacaccctaacatcaccccaacaactattcctcactccttatggcacactccaatgccata |
3425920 |
T |
|
| Q |
106 |
tctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccacgatg |
203 |
Q |
| |
|
|||||||||||||||||| || ||||| || ||||||||||||||||| |||| |||||||||||| | ||||| |||||||||| ||||||| |||| |
|
|
| T |
3425919 |
tctctttggaggactagctgctattataggtctcatagccttggcgttattggtactagcatgctcatattgtagactctcaagggacaaccaagatg |
3425822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University