View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_439 (Length: 217)
Name: NF9795A_low_439
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_439 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 2 - 217
Target Start/End: Complemental strand, 4082858 - 4082641
Alignment:
| Q |
2 |
atttaatggttttgtttcttggcaaatgatgattgaagggtgtctggggaattcaaattcctatagaaatatatatg--gttttgggaaatgatcaaatg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4082858 |
atttaatggttttgtttcttggcaaatgatgattgaagggtgtctggggaattgaaattcctatagaaatatatatatagttttgggaaatgatcaaatg |
4082759 |
T |
 |
| Q |
100 |
gaaannnnnnnnnnnnnnnnnnnnnnnnnaagaaaaccgtatatggttgctcgaattttggagttgtagggaaggaaacatgtaggggaaagagagagtc |
199 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082758 |
gaaattttgttttttggtttggtttgttgaagaaaaccgtatatggttgctcaaattttggagttgtagggaaggaaacatgtaggggaaagagagagtc |
4082659 |
T |
 |
| Q |
200 |
taaacttggaaaatttag |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4082658 |
taaacttggaaaatttag |
4082641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University