View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_442 (Length: 216)
Name: NF9795A_low_442
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_442 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 12 - 216
Target Start/End: Original strand, 32103473 - 32103677
Alignment:
| Q |
12 |
aatatatagtgagtgaggaagaggaaaagaaaatgatgacgtacagttgttgtgggcaaagttgccagaagaggctataagtccactgaacagattgcac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103473 |
aatatatagtgagtgaggaagaggaaaagaaaatgatgacgtacagttgttgtgggcaaagttgccagaagaggctataagtccactgaacagattgcac |
32103572 |
T |
 |
| Q |
112 |
cgcagcctgcaacatgttttgaagcttactgcctaatggagatggagccgccattctttattcattcagtcattaccaaacagttttttctttcatttct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32103573 |
cgcagcctgcaacatgttttgaagcttactgcctaatggagatggagcagccattctttattcattcagtcattaccaaacagttttttctttcatttct |
32103672 |
T |
 |
| Q |
212 |
ctgca |
216 |
Q |
| |
|
||||| |
|
|
| T |
32103673 |
ctgca |
32103677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University