View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_446 (Length: 214)
Name: NF9795A_low_446
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_446 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 213
Target Start/End: Original strand, 33104506 - 33104700
Alignment:
| Q |
19 |
ttgtttgcatatgcacaggtttgtttatggctctacaacccaagatgattgcatgtggaaactcagttgcttcatttgcaatggctgttcgatttcttac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33104506 |
ttgtttgcatatgcacaggtttgtttatggctctacaacccaagatgattgcatgtggaaactcagttgcttcatttgcaatggctgttcgatttcttac |
33104605 |
T |
|
| Q |
119 |
aggtcctgcagtcatggctgcagtttccactgctgttggactgcgtggtaaccttttacgtgtagctcttgttcaggtatataattaaccttgat |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33104606 |
aggtcctgcagtcatggctgcagcttccattgctgttggactgcgtggtaaccttttacgtgtagctattgttcaggtatataattaaccttgat |
33104700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 35 - 196
Target Start/End: Complemental strand, 10835967 - 10835806
Alignment:
| Q |
35 |
aggtttgtttatggctctacaacccaagatgattgcatgtggaaactcagttgcttcatttgcaatggctgttcgatttcttacaggtcctgcagtcatg |
134 |
Q |
| |
|
|||| ||||||||||||| ||||||||||| ||||||||||| || || |||||||||||||| |||||| | |||| ||||| ||||| ||||| ||| |
|
|
| T |
10835967 |
aggtctgtttatggctcttcaacccaagatcattgcatgtgggaattctgttgcttcatttgccatggctataagattccttactggtccagcagttatg |
10835868 |
T |
|
| Q |
135 |
gctgcagtttccactgctgttggactgcgtggtaaccttttacgtgtagctcttgttcaggt |
196 |
Q |
| |
|
|| |||| ||| | || ||||| || ||||| | ||| ||| ||||||| |||||||||| |
|
|
| T |
10835867 |
gcagcagcttctatcgccgttggcctccgtgggaccctcctacatgtagctattgttcaggt |
10835806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University