View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_461 (Length: 207)
Name: NF9795A_low_461
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_461 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 16 - 150
Target Start/End: Original strand, 2985185 - 2985319
Alignment:
| Q |
16 |
aagaatattggctgagccttcattgcattgacccttaaagtcggagccatctcttacacactttccatctccacacaaattaaacaaacaagctgtgtag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2985185 |
aagaatattggctgagccttcattgcattgacacttaaagtcggagccatctcttacacactttccatctccacacaaattaaacaaacatgctgtgtag |
2985284 |
T |
 |
| Q |
116 |
tataaaacactcaaattagcttatgtactaaattt |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2985285 |
tataaaacactcaaattagcttatgtactaaattt |
2985319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University