View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_464 (Length: 206)
Name: NF9795A_low_464
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_464 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 179683 - 179478
Alignment:
| Q |
1 |
ggaggcaactggtttattaggacgttgatatctgacattgcacctagtttagccaaatagtcagcattttgatttccttccgggagggtgtggttgagca |
100 |
Q |
| |
|
|||||| |||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
179683 |
ggaggcgactggtgtattagaacgttgacatctgacattgcacctagtttagccaaatagtcagcactttgatttccttcccggagggtgtggttgagcg |
179584 |
T |
|
| Q |
101 |
aaaaattttttagagaaagcttgtctctgatttcttggataagggttacatgaatatggaattttgatctggtggtattgatgagattaattgaaaggag |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||| |||| ||||||||||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
179583 |
aaaaattccttagagaaagcttgtctctgatatcttggattagggccgcatgaatatggaactttgaactggtggtagtgatgagattaattgaaaggag |
179484 |
T |
|
| Q |
201 |
agaatc |
206 |
Q |
| |
|
|||||| |
|
|
| T |
179483 |
agaatc |
179478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University