View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_474 (Length: 203)
Name: NF9795A_low_474
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_474 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 40 - 181
Target Start/End: Complemental strand, 6323375 - 6323237
Alignment:
| Q |
40 |
tggtgttgcaacgaaggaagaccaagtgaatattccttcgggatcaaaaacaaagattgatgatttgaaattaagatgacactgtgtttgtatcatcaca |
139 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6323375 |
tggtgttgcgacgaaggaagaccaagtgaatg---ctttgggatcaaaaacaaagattgatgatttgaaattaagatgacactgtgtttgcatcatcaca |
6323279 |
T |
|
| Q |
140 |
ggaacactgagacaaatcgccgccacaaacacaagcgaggaa |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6323278 |
ggaacactgagacaaatcgccgccacaaacacaagcgaggaa |
6323237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University