View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_476 (Length: 203)
Name: NF9795A_low_476
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_476 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 30841580 - 30841750
Alignment:
| Q |
1 |
cgtcacagagaccattgttgggttacgagaggagcccgatggatcatcctcattagactaagagcgatcatacaagtgaattgtacaccccatctttact |
100 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30841580 |
cgtcacagagaccactgttgcgttacgagaggagcccgatggatcatccacattggactcagagcgatcatacaagtgaattgtacaccccatctttact |
30841679 |
T |
|
| Q |
101 |
caaaatcgtaaccttcacttttaaaacaatgtaaaacttctacctcatatttgctaaacaacattaattat |
171 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30841680 |
caaaatcgtaacctccactttttaaacaatgtaaaacttctacctcatatttgctaaacaacattaattat |
30841750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University