View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_9 (Length: 466)
Name: NF9795A_low_9
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 3e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 243 - 435
Target Start/End: Original strand, 18057668 - 18057860
Alignment:
| Q |
243 |
tcagctattcggttatgtctggaagggtgttttggtctgcagatttttctgttttgccttgcctatattgtttggcggtgcggttcatgttgggtttttg |
342 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| || || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18057668 |
tcagctgttcggttatgtctggaagggtgttttgatcaacaaattttaatgttttgccttgcctatattgtttggcggtgcggttcatgttgggtttttg |
18057767 |
T |
|
| Q |
343 |
cggtagtggagctttgtttcggcaaaagggtgtgagacaggggattgcgtgttttctttcgcatgtatatgtcggtatcaatacctgagtccc |
435 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18057768 |
cggtagtggagctttgtttcggcaaaagggtgtgagacaggggtttgcgtgttttctttcgcatgtatatgtcggcatcaatacctgagtccc |
18057860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 14 - 167
Target Start/End: Original strand, 18057437 - 18057590
Alignment:
| Q |
14 |
gacatcatggaggaggtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggtgttggaatccccaat |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18057437 |
gacattatggaggaggtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggcgttggaatccccaat |
18057536 |
T |
|
| Q |
114 |
tttgccttgctaggagagcttcgcggacataaagggataccatccgggctgcta |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
18057537 |
tttgccttgctaggagagcttcgcggacataaagggataccatctgggctgcta |
18057590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 29 - 127
Target Start/End: Original strand, 16687653 - 16687751
Alignment:
| Q |
29 |
gtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggtgttggaatccccaattttgccttgctagg |
127 |
Q |
| |
|
|||||||| ||||||||||||||| | | |||||||||| | | | ||||||| ||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
16687653 |
gtgaaagtgttgtcttggaggtgggtgctttgtaggatgcatttgctggcttgtctatttttcgaatggtgttggaatcccaaattgtgccttgctagg |
16687751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 29 - 127
Target Start/End: Original strand, 17661889 - 17661987
Alignment:
| Q |
29 |
gtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggtgttggaatccccaattttgccttgctagg |
127 |
Q |
| |
|
|||||||| ||||||||||||||| | | |||||||||| | | | ||||||| ||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
17661889 |
gtgaaagtgttgtcttggaggtgggtgctttgtaggatgcatttgctggcttgtctatttttcgaatggtgttggaatcccaaattgtgccttgctagg |
17661987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 21 - 127
Target Start/End: Original strand, 8453182 - 8453288
Alignment:
| Q |
21 |
tggaggaggtgaaagtattgtcttggaggtggacgtgtagtaggatgcacattccgacttgtctcattttcgagtggtgttggaatccccaattttgcct |
120 |
Q |
| |
|
||||||||||||| || ||||||||||| |||| || ||||||||||| |||||| | || || ||| ||||| |||||||| |||||||| ||||| |
|
|
| T |
8453182 |
tggaggaggtgaaggtgttgtcttggagatggatgttgagtaggatgcatattccggcatgccttttttatgagtgatgttggaacccccaattgtgcct |
8453281 |
T |
|
| Q |
121 |
tgctagg |
127 |
Q |
| |
|
|| |||| |
|
|
| T |
8453282 |
tggtagg |
8453288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University