View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9795_high_4 (Length: 249)

Name: NF9795_high_4
Description: NF9795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9795_high_4
NF9795_high_4
[»] chr8 (2 HSPs)
chr8 (129-241)||(30472270-30472382)
chr8 (1-31)||(30472142-30472172)


Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 129 - 241
Target Start/End: Original strand, 30472270 - 30472382
Alignment:
129 agttgagtgatatttttgtcagtgatttgatgtccgaagtgtatggattttctgttggatgttccgcctatctacgtcaccttttacttgtttttgtgtt 228  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
30472270 agttgagtgatatttttgtcggtgatttgatgtccgaagtgtatggattttctgttgggtgttccgcctatctacgtcaccttttacttgtttttgtgtt 30472369  T
229 gttgatctctgct 241  Q
    |||| ||||||||    
30472370 gttggtctctgct 30472382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 30472142 - 30472172
Alignment:
1 tttgcaatggtggttgaagatttggctcaca 31  Q
    |||||||||||||||||||||||||||||||    
30472142 tttgcaatggtggttgaagatttggctcaca 30472172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University