View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795_low_5 (Length: 370)
Name: NF9795_low_5
Description: NF9795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 141 - 353
Target Start/End: Complemental strand, 40253448 - 40253236
Alignment:
| Q |
141 |
actttacatgttttgttagaaattgttgtaccttttttcatttacttagacataaattaattattaagtactaattttttggttatgaatttctttgcta |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40253448 |
actttacatgttttgttagaaattgttgtaccttttttcatttacttagacataaattaattattaagtactaattttttggttatgaatttctttgcta |
40253349 |
T |
 |
| Q |
241 |
gtcttgagttttagattagaagtactaatatttatcttttcaaaactaacctataaggttagggttcagaccttatattttttcaacatataacatgtgt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40253348 |
gtcttgagttttagattagaagtactaatatttatcttttcaaaactaacctataaggttagggttcagaccttatattttttcaacatataacatgtgt |
40253249 |
T |
 |
| Q |
341 |
tttttccaatata |
353 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40253248 |
tttttccaatata |
40253236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 16 - 81
Target Start/End: Complemental strand, 40253519 - 40253454
Alignment:
| Q |
16 |
gattcaagaagattttacttttgaggagtctatgttctaaggaatgatccaaacgcaataacatat |
81 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
40253519 |
gattcaagaagattttacttttgacgagtctatgttctatggaatgatccaaacgcaatagcatat |
40253454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University