View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795_low_7 (Length: 301)
Name: NF9795_low_7
Description: NF9795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795_low_7 |
 | |
|
| [»] scaffold0153 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 283; Significance: 1e-158; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 6370876 - 6370586
Alignment:
| Q |
1 |
atggttgtcataatccggcttggcctgagtttgttccgtcaagtgggaaggaaaaaactaggaagatggattatgtaagatatggtggtcattttttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6370876 |
atggttgtcataatccggcttggcctgagtttgttccgtcaagtgggaaggaaaaaactaggaagatggattatataagatatggtggtcattttttgat |
6370777 |
T |
|
| Q |
101 |
tggaattaggggtcctagagaggatgctgttgaaattaggaagaaaattgttgagttttgtgagaatacttttgggttaaggttagataattccaagttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6370776 |
tggaattaggggtcctagagaggatgctgttgaaattaggaagaaaattgttgagttttgtgagaatacttttgggttaaggttagataattccaagttg |
6370677 |
T |
|
| Q |
201 |
gagattgaacatattgcaaggggtattcaattcttggatcatataatatgcagaagggtgatacatccaactttgaggtacacaggttctg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6370676 |
gagattgaacatattgcaaggggtattcaattcttggatcatataatatgcagaagggtgatacatccaactttgaggtatacaggttctg |
6370586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 1166426 - 1166499
Alignment:
| Q |
19 |
cttggcctgagtttgttccgtcaagtgggaaggaaaaaactaggaagatggattatgtaagatatggtggtcat |
92 |
Q |
| |
|
||||||| |||||||| ||| | ||||| ||| ||||||||||||||||||| | |||||||||| |||||| |
|
|
| T |
1166426 |
cttggccggagtttgtgccgactagtggaccggataaaactaggaagatggattttataagatatggaggtcat |
1166499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0153 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0153
Description:
Target: scaffold0153; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 28080 - 28153
Alignment:
| Q |
19 |
cttggcctgagtttgttccgtcaagtgggaaggaaaaaactaggaagatggattatgtaagatatggtggtcat |
92 |
Q |
| |
|
||||||| |||||||| ||| | ||||| ||| ||||||||||||||||||| | |||||||||| |||||| |
|
|
| T |
28080 |
cttggccggagtttgtgccgactagtggaccggataaaactaggaagatggattttataagatatggaggtcat |
28153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University