View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795_low_9 (Length: 249)
Name: NF9795_low_9
Description: NF9795
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 129 - 241
Target Start/End: Original strand, 30472270 - 30472382
Alignment:
| Q |
129 |
agttgagtgatatttttgtcagtgatttgatgtccgaagtgtatggattttctgttggatgttccgcctatctacgtcaccttttacttgtttttgtgtt |
228 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30472270 |
agttgagtgatatttttgtcggtgatttgatgtccgaagtgtatggattttctgttgggtgttccgcctatctacgtcaccttttacttgtttttgtgtt |
30472369 |
T |
 |
| Q |
229 |
gttgatctctgct |
241 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
30472370 |
gttggtctctgct |
30472382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 30472142 - 30472172
Alignment:
| Q |
1 |
tttgcaatggtggttgaagatttggctcaca |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
30472142 |
tttgcaatggtggttgaagatttggctcaca |
30472172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University