View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9796_low_6 (Length: 277)
Name: NF9796_low_6
Description: NF9796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9796_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 37 - 270
Target Start/End: Original strand, 6453910 - 6454143
Alignment:
| Q |
37 |
gtgcaaagaaagatagtactttgatgaccactgctactaatattatctcaggcctcagcttccataaataactagtactacactaccctttttcactaac |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
6453910 |
gtgcaaagaaagatagtactttgatgaccactgctactaatattatatcaggcctcagcttccataaataactagtactatacttccctttttcactaac |
6454009 |
T |
|
| Q |
137 |
ttttcgctcaaaccaccatccccnnnnnnnctctgatcttttctctttctcttcatttaatcttttttcctttatnnnnnnntctctatctctgactaag |
236 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6454010 |
ttttcgctcaaaccaccatccccaaaaaaactctgatcttttctctttctcttcatttaatcttttttcctttat-aaaaaatctctatctctgactaag |
6454108 |
T |
|
| Q |
237 |
ttactagt-agtctctggaaaaattaattcatctc |
270 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
6454109 |
ttactagtaagtctctggaaaaattaattcatctc |
6454143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University