View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9797_high_3 (Length: 234)
Name: NF9797_high_3
Description: NF9797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9797_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 40629718 - 40629940
Alignment:
| Q |
1 |
cctgataccacccaatctactgcaaagctagccatgcgacctcagctctgcctaattaactaatannnnnnnnnnnnnnnnccaaatatagtaaggaatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40629718 |
cctgataccacccaatctactgcaaagctagccatgcaacctcagctctgcctaattaactaatattttttatttgtttttccaaatatagtaaggaatg |
40629817 |
T |
 |
| Q |
101 |
tactcttgctctacttccaaccctcctttgggaatgtaatttgaagttgcacacttttcttaatgaatgaaagtaagtaaattggtttggtttgtttctt |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40629818 |
tactcttgctctgcttccaaccctcctttgggaatgtcatttgaagttgcacactttttttaatgaatgaaagtaagtaaattggtttggtttgtttctt |
40629917 |
T |
 |
| Q |
201 |
tgattggacttggaagaggatga |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40629918 |
tgattggacttggaagaggatga |
40629940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 92 - 223
Target Start/End: Complemental strand, 40655133 - 40655014
Alignment:
| Q |
92 |
taaggaatgtactcttgctctacttccaaccctcctttgggaatgtaatttgaagttgcacacttttcttaatgaatgaaagtaagtaaattggtttggt |
191 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||| |||||||||| ||||||| |||| ||| |||||||||||||||||| ||| | |
|
|
| T |
40655133 |
taaggaatgtactcttgctttgcttccaaccctccttttggaatgtaat------ttgcacaattttttta--taatgaaagtaagtaaatt--ttt--t |
40655046 |
T |
 |
| Q |
192 |
ttgtttctttgattggacttggaagaggatga |
223 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| |
|
|
| T |
40655045 |
ttgtttctttgtttggacttggaggaggatga |
40655014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University