View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9797_low_2 (Length: 335)
Name: NF9797_low_2
Description: NF9797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9797_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 274
Target Start/End: Complemental strand, 39183911 - 39183637
Alignment:
| Q |
1 |
tatcctttaaggattttagagtacagtttgactttgagttattaccctggctttgcatgtaaatgaactcttcaaaatcttgtgtgagcttatacaatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39183911 |
tatcctttaaggattttagagtacagtttgactttgagttattaccctggctttccatgtaaatgaactcttcaaaatcttgtgcgagcttatacaatta |
39183812 |
T |
 |
| Q |
101 |
ctgtatttgtaatccttggtttaagtttttaattgctttctctagtttaagatggctagtgggcgttatgtgctgtagcctgttcaaccttttgcttgan |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39183811 |
ctgtatttgtaatccttggtttaagtttttaattgctttctctagtttaagatggctagtgggcgttatgtgctgtagcctgttcaaccttttgcttgat |
39183712 |
T |
 |
| Q |
201 |
nnnnnnattttaaaatgtttatctaatatgtaactgctaccag-agagccgagtgttgcttatgtgcatggattc |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
39183711 |
ttttttattttaaaatgtttatctaatatgtaactgctacctgtagagccgagtgttgcttatgtgcatggattc |
39183637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University