View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9797_low_4 (Length: 268)
Name: NF9797_low_4
Description: NF9797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9797_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 40094055 - 40094304
Alignment:
| Q |
1 |
actacttacatattataggtaaatgatcagcttgaaaattattagaaagctccagagtattaaaacatgcatgcacatgtgagcagtaacggtatagatt |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||| ||||| |
|
|
| T |
40094055 |
actacttgcatattataggtaaatgatcagcttgaaaattattagaaagctccagagtattaaaacatgcatgcacatgtgagcagtgatggtaaagatt |
40094154 |
T |
|
| Q |
101 |
tagatatttacctcttgtaatatcagagcaaaagaaaacgcatccactttggtgtcatattcctcatttctgtagacctccggtgcaacataccgccctg |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40094155 |
tagatttttacctcttgtaatatcagagcaaaagaaaacgcatccactttggtgtcatattcctcatttctgtagacctctggtgcaacataccgccctg |
40094254 |
T |
|
| Q |
201 |
ttatgcatttgaatttgaattaattcatctataagagctacacaaaacag |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40094255 |
ttatgcatttgaatttgaattaattcatctataagagctacacaaaacag |
40094304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University