View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9797_low_8 (Length: 219)
Name: NF9797_low_8
Description: NF9797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9797_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 20 - 207
Target Start/End: Complemental strand, 1155370 - 1155183
Alignment:
| Q |
20 |
gtattcaagtttccaagactaagaagcctctcttcttctaccttaacatcgctaaggtaattaggttttcgattttgattcaatcgctttttcttcattt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
1155370 |
gtattcaagtttccaagactaagaagccactcttcttctaccttaacatcgctaaggtaattaggttttcgattttgattaaatcgccgtttcttcattt |
1155271 |
T |
|
| Q |
120 |
cgnnnnnnnnatttctgattatgaatttcgtgtttctttctgattcagaaacacttgaagctggataatgatgttgagctctctgctt |
207 |
Q |
| |
|
|| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1155270 |
cgtttttttcatttctgattatggatttcgtgtttctttctgattcagaaacacttgaagctggataatgatgttgagctctgtgctt |
1155183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 149 - 207
Target Start/End: Original strand, 38664985 - 38665043
Alignment:
| Q |
149 |
gtgtttctttctgattcagaaacacttgaagctggataatgatgttgagctctctgctt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38664985 |
gtgtttctttctgattcagaaacacttgaagctggataatgatgttgagctctatgctt |
38665043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University