View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9798_high_28 (Length: 248)
Name: NF9798_high_28
Description: NF9798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9798_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 20978588 - 20978820
Alignment:
| Q |
18 |
ttatcaaaggtaaactttaagttagtgtctacacatttagttgaaattgaaannnnnnngtacatggttgaaatattttaaagtgatgattactccatca |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20978588 |
ttatcaaaggtaaactttaatttagtgtctacacatttagttgaaattgaaatgtttttgtacatggttgaaatattttaaagtgttgattactccatca |
20978687 |
T |
 |
| Q |
118 |
tcttcatcccatagatgtttttgtacaggtcaggtctagctataaattgctgaacacacgcaaatttttgatagatactagtagcaataat-------ag |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| | |
|
|
| T |
20978688 |
tcttcatcccataaatgtttttgtacaggtcaggtctagctataaattgctgaacacacgcaaattcttgatagatactggtagcaataatactaataaa |
20978787 |
T |
 |
| Q |
211 |
taataataatagtagtctacttgtcctttgctt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20978788 |
taataataatagtagtctacttgtcctttgctt |
20978820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University