View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9798_low_26 (Length: 254)
Name: NF9798_low_26
Description: NF9798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9798_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 25760317 - 25760094
Alignment:
| Q |
18 |
gtctttctactttgagcctccacacccattttctcccaaataaattaaaacctctcaacaattttgcac-aaacccacccttccatatctagctctcctc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| | |
|
|
| T |
25760317 |
gtctttctactttgagcctccacacccattttctcccaaataaattaaaacctctcaacaatattgcaccaaacccacccttccatatctagctctccac |
25760218 |
T |
 |
| Q |
117 |
acactctatcccaactaacccatagaatataggatagtgtaatggttttcatagaaaactcatcaagtactgcctaagttggagtgaaatagttttcata |
216 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25760217 |
acactctgtcccaactaacccatagaaaataggatagtgtaatggttttcatagaaaactcatcaagt-ctgcctaagttggagtgaaatagttttcata |
25760119 |
T |
 |
| Q |
217 |
cggcacacaaagtcatcacttccct |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
25760118 |
cggcacacaaagtcatcacttccct |
25760094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University