View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9798_low_37 (Length: 237)
Name: NF9798_low_37
Description: NF9798
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9798_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 29959182 - 29959399
Alignment:
| Q |
1 |
tgactcatccaaatttgtgtaatgttttgccttgatgtttggtttcatcatgataaacataacatttcactctcaatgatcccacacgtgaaagagagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29959182 |
tgactcatccaaatttgtgtaatgttttgccttgatgtttggtttcatcatgataaacataacatttcactctcaatgatcccacacgtgaaagagagta |
29959281 |
T |
 |
| Q |
101 |
caaggaatttgacatgactagttttacgatctatatttggacaacaccatgctcatgttaaggatnnnnnnncatcgtttctaccctaattttagctcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
29959282 |
caaggaatttgacatgactagttttacgatctatatttggacaacaccatgctcatgttaaggataaaaaaacatagtttctaccctaattttagctcaa |
29959381 |
T |
 |
| Q |
201 |
tgtttggtaccaaccata |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29959382 |
tgtttggtaccaaccata |
29959399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University