View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9799_high_4 (Length: 271)
Name: NF9799_high_4
Description: NF9799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9799_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 43977177 - 43977077
Alignment:
| Q |
40 |
ggataggaggaattttagttaaatttatatttggttaacgagcgagagtgaggaggaattttaaaactaaaacattctcatgattttaaaactattttat |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43977177 |
ggataggaggaattttagttaaatttatatttggttaacgag----agtgaggaggaattttaaaactaaaacattctcctgattttaaaactattttat |
43977082 |
T |
|
| Q |
140 |
taaac |
144 |
Q |
| |
|
||||| |
|
|
| T |
43977081 |
taaac |
43977077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University