View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9799_low_10 (Length: 225)

Name: NF9799_low_10
Description: NF9799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9799_low_10
NF9799_low_10
[»] chr4 (1 HSPs)
chr4 (21-209)||(336171-336359)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 21 - 209
Target Start/End: Original strand, 336171 - 336359
Alignment:
21 tctgaaagtgtttttgtacctcttagattaattactgataacgtgttgtcagattttgatgttttcatttcatgagaaataaaacttctgggaaaaaagg 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
336171 tctgaaagtgtttttgtacctcttagattaattactgataacgtgttgtcagattttgatgttttcatttcatgagaaataaaacttctgggaaaaaagg 336270  T
121 ttttatgggcttgaaattggacacgtctaaaatctatgacaaaattgaatgatcgtttcttaaaacagtttcagcaacaatggacctct 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||    
336271 ttttatgggcttgaaattggacacgtctaaaatctatgacaaaattgaatgaccatttcttaaaacagtttcagcaacaatggacctct 336359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University