View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9799_low_12 (Length: 213)

Name: NF9799_low_12
Description: NF9799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9799_low_12
NF9799_low_12
[»] chr6 (1 HSPs)
chr6 (20-67)||(2091365-2091412)


Alignment Details
Target: chr6 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 20 - 67
Target Start/End: Original strand, 2091365 - 2091412
Alignment:
20 tggtcacaaccctaaataaaataaaaataatttagtcacatcagttaa 67  Q
    |||||||||||||||||||||||||||||||||| |||||||| ||||    
2091365 tggtcacaaccctaaataaaataaaaataatttaatcacatcaattaa 2091412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University