View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9799_low_12 (Length: 213)
Name: NF9799_low_12
Description: NF9799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9799_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 20 - 67
Target Start/End: Original strand, 2091365 - 2091412
Alignment:
| Q |
20 |
tggtcacaaccctaaataaaataaaaataatttagtcacatcagttaa |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
2091365 |
tggtcacaaccctaaataaaataaaaataatttaatcacatcaattaa |
2091412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University