View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9799_low_5 (Length: 271)

Name: NF9799_low_5
Description: NF9799
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9799_low_5
NF9799_low_5
[»] chr7 (1 HSPs)
chr7 (40-144)||(43977077-43977177)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 40 - 144
Target Start/End: Complemental strand, 43977177 - 43977077
Alignment:
40 ggataggaggaattttagttaaatttatatttggttaacgagcgagagtgaggaggaattttaaaactaaaacattctcatgattttaaaactattttat 139  Q
    ||||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
43977177 ggataggaggaattttagttaaatttatatttggttaacgag----agtgaggaggaattttaaaactaaaacattctcctgattttaaaactattttat 43977082  T
140 taaac 144  Q
    |||||    
43977081 taaac 43977077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University