View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9800_high_10 (Length: 263)
Name: NF9800_high_10
Description: NF9800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9800_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 129 - 261
Target Start/End: Complemental strand, 31753367 - 31753235
Alignment:
| Q |
129 |
aaccagttgaaccgtctagtccggtttggtttgattttcaaaacattggtttcaactagaaatcgaactcagagactaccaaaataatttgaacttggct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31753367 |
aaccagttgaaccgtctagtccggtttggtttaattttcaaaacattggtttcaactagaaatcgaactcagagactaccaaaataatttgaacttggct |
31753268 |
T |
 |
| Q |
229 |
gaaacacataaacatttaagtctaacccctttg |
261 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
31753267 |
gaaacacataaacatttaagtctaaccactttg |
31753235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 18 - 99
Target Start/End: Complemental strand, 31753497 - 31753416
Alignment:
| Q |
18 |
gatcagtggttgtatcgaccaatgttttaaaaaccaagccagacatcaactgttttataccagtcaaaatggggtgaaactg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31753497 |
gatcagtggttgtatcgaccaatgttttaaaaaccaagccagacatcaactgttttataccagtcaaaatggggtgaaactg |
31753416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 94 - 132
Target Start/End: Complemental strand, 31753393 - 31753355
Alignment:
| Q |
94 |
aaactgacagttctagtccacggttcaaccagttgaacc |
132 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31753393 |
aaacggacagttctagtccacggttcaaccagttgaacc |
31753355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University