View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9800_high_16 (Length: 231)
Name: NF9800_high_16
Description: NF9800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9800_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 29 - 214
Target Start/End: Original strand, 53790131 - 53790316
Alignment:
| Q |
29 |
gcataggtacacatttggttatgataacttcactggatcttataaggtagtgttaatgtgttctggcatggtgaaaattttcaatataggtgataatatt |
128 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
53790131 |
gcataggtacatatttggttatgataacttcactggatcttacaaggtagtgttaatgtgttctggcaaggtgaaaattttcaatataggtgataatatt |
53790230 |
T |
|
| Q |
129 |
tggactgaaatttcaaattttcctcgttttgagcacgatgtttctcttggctctgatcgtgtgaataatggagtgtatttgaatgg |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53790231 |
tggactgaaatttcaagttttcctcgttttgaccacgatgtttctcttggctctgatcgtgtgaataatggagtgtatttgaatgg |
53790316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University