View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9800_high_6 (Length: 360)
Name: NF9800_high_6
Description: NF9800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9800_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 351
Target Start/End: Complemental strand, 10805093 - 10804759
Alignment:
| Q |
18 |
aaaatcagattcaaagtgttatcttatcccatggtttatttttgtttccttattcctttatcagtcttgatgttgtgtctgaatgaatatcttctctttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10805093 |
aaaatcagattcaaagtgttatcttatcccatggtttatttttgtttccttattcctttatcagtcttgatgttgtgtcttaatgaatatcttctctttg |
10804994 |
T |
 |
| Q |
118 |
agatgcatatggttagttatttcttaatctaaaatttcatgtgttcattttgagaattttgtctttaggtagnnnnnnnnnnnnnatgt-nnnnnnnnnc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| | |
|
|
| T |
10804993 |
agatgcatatggttagttatttcttaatctaaaatttcatgtgttcattttgagaattttgtctttagctagtttttttctttttatgtaaaaaaaaaac |
10804894 |
T |
 |
| Q |
217 |
acatgaaatctttggatattgtaagtcctgaagatagaaaaatgccaaaacagaatgttaacacaaagttaaaaagatggagaagtgtttatattttcat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10804893 |
acatgaaatctttggatattgtaagtcctgaagatagaaaaatgccaaaacagaatgttaacacaaagttaaaaagatggagaagtgtttatattttcat |
10804794 |
T |
 |
| Q |
317 |
ctttatagccggtgctattgctcttctcctctctg |
351 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||| |
|
|
| T |
10804793 |
ctttatagctggtgctattgctcttctcctttctg |
10804759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University