View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9800_low_24 (Length: 229)
Name: NF9800_low_24
Description: NF9800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9800_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 7 - 115
Target Start/End: Original strand, 34308707 - 34308815
Alignment:
| Q |
7 |
cgatggtcatggttgatacgaggattaatcgggtgtatcattgaacatgaagtagcttacacagttggatcgtggattaggtcttgacccaatccaaaat |
106 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34308707 |
cgatggtcatggttgatgcgaggattaatcgggtgtatcgttgaacatgaagtagcttacacagttggatcgtggattaggtcttgacccaatccaaaat |
34308806 |
T |
|
| Q |
107 |
accagttac |
115 |
Q |
| |
|
||||||||| |
|
|
| T |
34308807 |
accagttac |
34308815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 114 - 229
Target Start/End: Original strand, 34308850 - 34308975
Alignment:
| Q |
114 |
actagtcagaactactaaaaaattattggacacaatatt-tct---ttaa------cggcattcggtatgcggtcacgtcttgtttattcttggtttttc |
203 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34308850 |
actagtcaaaactactaaaaaattattggacacaatattctctaccttaaatctcacggcattcggtatgcggtcacgtcttgtttattcttggtttttc |
34308949 |
T |
|
| Q |
204 |
ttgtttaatattgtgcgactaaatca |
229 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
34308950 |
ttgtttaatattgtgcgactaaatca |
34308975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University