View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9802_low_16 (Length: 285)
Name: NF9802_low_16
Description: NF9802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9802_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 275
Target Start/End: Complemental strand, 42514855 - 42514596
Alignment:
| Q |
19 |
gttttgcttctattact---gctagtaattgttctatggttagatgtgtatgcgcaccctgcctactgttgctgcatcaaattggaattccaccttaatt |
115 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42514855 |
gttttgcttctattactactgctagtaattgttctatggttaaatgtgtatgcgcaccctgcctactgttgctgcatcaaattggaattccacctgaatt |
42514756 |
T |
 |
| Q |
116 |
atatcttatttcatttacatatatccttagttttatctatttccatgtgtttttgtgcgcttctgtgatcagctagatctgagacaatgtactcaagaag |
215 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42514755 |
atatcttatttcattttcatatttccttagttttatctatttccatgtgtttttgtgcgcttatgtgatcagctagatctgagacaatgtactcaagaag |
42514656 |
T |
 |
| Q |
216 |
tttgtcatagcaagacctgcttaatatgtattttccttcttgttttgtcatgtacctatg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42514655 |
tttgtcatagcaagacctgcttaatatgtattttctttcttgttttgtcatgtacctatg |
42514596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University