View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9802_low_18 (Length: 281)
Name: NF9802_low_18
Description: NF9802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9802_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 27888712 - 27888447
Alignment:
| Q |
1 |
gtgagcaaagaaggttggtttgaggaaagtttggcgcgtagaattggcaatgatgagatttcttccttttgaaacaatccttgtctagaagaaggaattt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
27888712 |
gtgagcaaaggaggttggtttgaggaaagtttggcgcgtagaattggcaatgatgaaatttcttccttttgaaacaatccttgcccagaagaaggaattt |
27888613 |
T |
|
| Q |
101 |
tatatttagttttctttttagccattatcttaatagtaatatttcagtagatgagatggggagttaggttgggggttgaggtttatacttgaaggtggag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27888612 |
tatatttagttttctttttagccattatcttaatagtaatatttcagtagatgagatggggagttaggttgggggttgaggtttatacttgaaggtggag |
27888513 |
T |
|
| Q |
201 |
aaagaggctttttactttgaaagaggagcaagtagttgagtgttgctctttgttggacaatattct |
266 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27888512 |
aaagaggctttttactttgaaagaggagtaagtagttgagtgttgctctttgctggacaatattct |
27888447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University