View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9802_low_27 (Length: 247)
Name: NF9802_low_27
Description: NF9802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9802_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 36026083 - 36026308
Alignment:
| Q |
1 |
agattgagttggatctcttgtgggttcttgctttacgaaatccgacacaatatttttccccggttctcttattcttttattaattctcttcattcaacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36026083 |
agattgagttggatctcttgtgggttcttgctttacgaaatccgacacaatatttttccccggttctcttattcttttattaattctcttcattcaacta |
36026182 |
T |
 |
| Q |
101 |
tggttttactgtcagttgatatttaataagaggacgttctagtactatcnnnnnnnnnnnnntaagaggacgttccagaatatgatatttttccacaaat |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36026183 |
tggtcttactgtcagttgatatttaataagaggacgttctagtactatcaaaaaaataaaaataagaggacgttccagaatatgatatttttccacaaat |
36026282 |
T |
 |
| Q |
201 |
gcttctggtaatgtagtatggagata |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36026283 |
gcttctggtaatgtagtatggagata |
36026308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University