View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9802_low_32 (Length: 238)
Name: NF9802_low_32
Description: NF9802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9802_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 51456874 - 51457096
Alignment:
| Q |
1 |
cacctgttttttggtggatggatggttcttctgttaaaattagtttatagacattctaccctcttgggttatgaagagataagattacaaggtttgtagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51456874 |
cacctgttttttggtggatggatggttcttctgttaaaattagtttatagacattctaccctcttgggttatgaagagataagagtacaaggtttgtagt |
51456973 |
T |
|
| Q |
101 |
tctacatgttaaaagaaatacaacattagggttgtgacttgtgagcctcaagccaattttttgagtgtaattggcatgtgttagtcataaagttgcagtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51456974 |
tctacatgttaaaagaaatacaacattagggttgtgacttgtgagcctcaagccaattttttgagtgtaattggcatgtgttagtcataaagtcgcagtc |
51457073 |
T |
|
| Q |
201 |
gttcatgcttgtcctatgttgtt |
223 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
51457074 |
gttcatgcttgtcatatgttgtt |
51457096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 157 - 190
Target Start/End: Original strand, 51439607 - 51439640
Alignment:
| Q |
157 |
ttttttgagtgtaattggcatgtgttagtcataa |
190 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
51439607 |
ttttttgagtgtaattggcatgtggtagtcataa |
51439640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University