View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9802_low_33 (Length: 235)
Name: NF9802_low_33
Description: NF9802
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9802_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 16 - 122
Target Start/End: Complemental strand, 32094660 - 32094554
Alignment:
| Q |
16 |
agatcaaagcaaactataaaaacatctgaacagaaaatcggattatttcactaaatctacagtcacaaaggcctaatagttcatgtttcatatctttacc |
115 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32094660 |
agatcaaagcaaattataaaaatatctgaacagaaaatcggattatttcactaaatctacagtcacaaaggcctaatagttcatgtttcatatctttacc |
32094561 |
T |
 |
| Q |
116 |
gataacc |
122 |
Q |
| |
|
||||||| |
|
|
| T |
32094560 |
gataacc |
32094554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 179 - 220
Target Start/End: Complemental strand, 32094499 - 32094458
Alignment:
| Q |
179 |
cactggatcaatgagaatttcccctctataaaggtctttttt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32094499 |
cactggatcaatgagaatttcccctctataaaggtctttttt |
32094458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University