View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9803_high_6 (Length: 208)
Name: NF9803_high_6
Description: NF9803
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9803_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 15 - 189
Target Start/End: Original strand, 40345365 - 40345532
Alignment:
| Q |
15 |
ataggtagtgagatcgaaaaattgtgtgcgttttggagagtctggcttagtttatttactactataatggagggggaatgtcagggagattgatcacgta |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40345365 |
ataggtagtgagatcgaaaaattgtgtacgttttggagagtctggcttagtttatttactactataatggagggggaatgtcagggagattgatcacgta |
40345464 |
T |
 |
| Q |
115 |
ctattattattatgacgatcattaaagttgatttgtgcatgcaaatgattgaactagttaaagaaatgagttcaa |
189 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40345465 |
c---tattattatgacgatcattaaagttgatttg----tgcaaatgattgaactagttaaagaaatgagttcaa |
40345532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University