View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9804_high_11 (Length: 239)
Name: NF9804_high_11
Description: NF9804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9804_high_11 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 13899281 - 13899501
Alignment:
| Q |
19 |
atcaaaaagattaattaatgctatattgcacaaagtaatttaaagaatttcaatgaagcttaaattgctcatttcaaacagaaggttggctttacaattg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13899281 |
atcaaaaagattaattaatgctatattgcacaaagtaatttaaagaatttcaatgaagcttaaattgctcatttcaaacagatggttggctttacaattg |
13899380 |
T |
|
| Q |
119 |
gcaattctttagcatattactagaaaataccaacgacatcaaccagtctgaggatgagaactcatagtactttgataaaaagacaaaagaagaaagaata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13899381 |
gcaattctttagcatattactagaaaataccaacgacatcaaccagtctgaggatgagaactcatagtactttgataaaaagacaaaagaagaaagaata |
13899480 |
T |
|
| Q |
219 |
gggggaaaaatattaagtaaa |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13899481 |
gggggaaaaatattaagtaaa |
13899501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University