View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9804_high_8 (Length: 339)
Name: NF9804_high_8
Description: NF9804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9804_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-115; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 80 - 334
Target Start/End: Original strand, 1349092 - 1349346
Alignment:
| Q |
80 |
gattgatcaaaggtttcttttcttctgcaggcagtgccattatatctatcagaaatggcactaccaagatatagaggagcaattaacattggcttccagc |
179 |
Q |
| |
|
||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1349092 |
gattgatcagaaatttcttttcttctgcaggcagtcccattatatctatcagaaatggcacttccaagatatagaggagcaatcaacattggcttccagc |
1349191 |
T |
 |
| Q |
180 |
tctgtgttggaattggtgttttatctgcaaatttaatcaactttggtacagaaaagatcaaagacggttggggatggcgaatttctctagccatggcagc |
279 |
Q |
| |
|
| ||||||||||| |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1349192 |
tttgtgttggaatcggtgttctatcagcaaatttaatcaactttggtacagaaaagatcaaagacggttggggatggcgaatttctctagccatggcagc |
1349291 |
T |
 |
| Q |
280 |
agttccagctacaatcctcactttaggagcatttttcctcccagaaacaccaaac |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1349292 |
agttccagctacaatcctcactttaggagcatttttccttccagaaacaccaaac |
1349346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 105 - 288
Target Start/End: Original strand, 1356071 - 1356254
Alignment:
| Q |
105 |
tgcaggcagtgccattatatctatcagaaatggcactaccaagatatagaggagcaattaacattggcttccagctctgtgttggaattggtgttttatc |
204 |
Q |
| |
|
|||||||||| || ||||||| |||||||||||| |||| |||| |||||| ||||| |||| ||||||||| | | |||| ||||||| ||| || |
|
|
| T |
1356071 |
tgcaggcagttcctctatatctctcagaaatggcattacctagatttagaggggcaataaacaatggcttccaattaagcattggtattggtgctttgtc |
1356170 |
T |
 |
| Q |
205 |
tgcaaatttaatcaactttggtacagaaaagatcaaagacggttggggatggcgaatttctctagccatggcagcagttccagc |
288 |
Q |
| |
|
||| ||| ||||||||| ||| ||||||||||| ||| ||||||||| ||||| | || ||||||||||||||||||||||| |
|
|
| T |
1356171 |
tgctaatctaatcaactatggaacagaaaagattgaaggcggttggggttggcgcgtatccctagccatggcagcagttccagc |
1356254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 1348997 - 1349055
Alignment:
| Q |
25 |
gtgtaaaacatgtttatggagtgaatgtatagttattaagctctttaattcattggattg |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1348997 |
gtgtaaaacatgtttatggagtgaatgtatagttattaagctcttt-attcattggattg |
1349055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University