View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9804_low_13 (Length: 330)
Name: NF9804_low_13
Description: NF9804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9804_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 172 - 316
Target Start/End: Original strand, 7972160 - 7972302
Alignment:
| Q |
172 |
attatgagatacaaccaagacaccgcacacaaaatgaataaacttacctcaaggaactaattcataaatcaacaaatatccaagcagaaatccttgatat |
271 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7972160 |
attatgagatacaaccaagacaccgcaca--aaatgaataaacttacctcaaggaactaattcataaatcaacaaatatccaagcagaaatccttgatat |
7972257 |
T |
|
| Q |
272 |
ttgcttttctgtaaatataaagaattaacttataagtttgataat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7972258 |
ttgcttttctgtaaatataaagaattaatttataagtttgataat |
7972302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University