View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9804_low_14 (Length: 318)
Name: NF9804_low_14
Description: NF9804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9804_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 4 - 282
Target Start/End: Original strand, 10170970 - 10171248
Alignment:
| Q |
4 |
aagtatgcaattatgtctgtgttgattcatcaaagtttggatttagtaaagcattgaacttttggttgtgtatttgtgtggtttgactttgtgattgtct |
103 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10170970 |
aagtatgcaattatgtctatgttgattcatcaaagtttggatttagtaaagcattgaacttctggttgtgtatttgtgtggtttgactttgtgattgtct |
10171069 |
T |
 |
| Q |
104 |
agtatagaacttatgttaggattgtttagttctgatcattttgttgagttgaaaaccttaattctgattagacacttaatatgaatgatattcaagtact |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10171070 |
agtatagaacttatgttaggcttgtttagttctgatcattttgttgagttgaaaaccctaattctgattagacacttaatatgaatgatattcaagtatt |
10171169 |
T |
 |
| Q |
204 |
gatcttttacaaatgtgttcttttaactcattatttaaacttagtgataaagcagcttagtatgaatagcattgtaatt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10171170 |
gatcttttacaaatgtgttcttttaactcattatttgagcttagtgataaagcagcttagtatgaatagcattgtaatt |
10171248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University