View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9804_low_18 (Length: 285)
Name: NF9804_low_18
Description: NF9804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9804_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 44946200 - 44945929
Alignment:
| Q |
1 |
ttataattaagtccattttctctgttgcattattacattatgaacaacatttccgttgcagctgcggatattttactatggaggaacaagaaatgcacag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44946200 |
ttataattaagtccattttctctgttgcattattacattatgaacaacatttccgttgcagctgcggatattttactatggaggaacaagaaatgcacag |
44946101 |
T |
 |
| Q |
101 |
caattgcacttggtgctggcactgccttgtaggttttctttgagttgatgcaatacaacctcataactcttgtttgccatttaatgattttggctcttgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44946100 |
caattgcacttggtgctggcactgccttgtgggttttctttgagttgatgcaatacaacctcataactcttgtttgccatttaatgattttggctcttgc |
44946001 |
T |
 |
| Q |
201 |
tgctcttttcttgtggtctaatgcatctgtctttatccacaagtaagtaagcctttcgaaattcatgtacct |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44946000 |
tgctcttttcttgtggtctaatgcatctgtctttatccacaagtaagtaagcctttcgaaattcatgtacct |
44945929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University