View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9804_low_9 (Length: 349)
Name: NF9804_low_9
Description: NF9804
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9804_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 13 - 336
Target Start/End: Complemental strand, 6111473 - 6111149
Alignment:
| Q |
13 |
agcataggttgtggagctctagttccatgctttggctgaaaatctagccatgtcaatattttt-ggcagtgatacacatgattttaagccaggagtagct |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111473 |
agcataggttgtggagctctagttccatgctttggctgaaaatctagccatgtcaatattttttggcagtgatacacatgattttaagccaggagtagct |
6111374 |
T |
 |
| Q |
112 |
ctgcatgtttcaattgatattgatgttcactcggttgcacttaacattggtgagtttggtgttccattttccttccttgtaggtagcagcagtatttcgc |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111373 |
ctgcatgtttcaattgatattgatattcactcggttgcacttaacattggtgagtttggtgttccattttccttccttgtaggtagcagcagtatttcgc |
6111274 |
T |
 |
| Q |
212 |
aagtctctaaggcttactcacgaagcgcgaaaacaatttgcatctggaaaaataaccaacttgatgactactgatgctgagtcacttcaggtatggtttt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111273 |
aagtctctaaggcttactcacgaagcgcgaaaacaatttgcatctggaaaaataaccaacttgatgactactgatgctgagtcacttcaggtatggtttt |
6111174 |
T |
 |
| Q |
312 |
cctttcctccctatcatctgatgtc |
336 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6111173 |
cctttcctccctatcatctgatgtc |
6111149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University