View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9805_high_10 (Length: 250)
Name: NF9805_high_10
Description: NF9805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9805_high_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 36 - 173
Target Start/End: Complemental strand, 34842414 - 34842277
Alignment:
| Q |
36 |
tcaaccaaattgttacctaaacacgattttttcgtataacattgaaaataaattaaaattaggttgcaaacatcttgaaacgtgtacaatcttcataatt |
135 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34842414 |
tcaaccaaattgttaactaaacacgatttttttgtataacgttgaaaataaattaaaattatgttgcaaacatcttgaaacgtatacaatcttcataatt |
34842315 |
T |
|
| Q |
136 |
gttttcgaaatgcatgcataactcatcacataaaacaa |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34842314 |
gttttcgaaatgcatgcataactcatcacataaaacaa |
34842277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 187 - 250
Target Start/End: Complemental strand, 34838540 - 34838477
Alignment:
| Q |
187 |
tatagttcttggaagaaacccttgaatggttggtataagatacatgtggatggttctcattggt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34838540 |
tatagttcttggaagaaacccttgaatggttggtataagatacatgtggatggttctcattggt |
34838477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University