View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9805_high_7 (Length: 309)
Name: NF9805_high_7
Description: NF9805
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9805_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 4 - 294
Target Start/End: Complemental strand, 8726685 - 8726395
Alignment:
| Q |
4 |
tgcaattccgcagactaattgactacggcaaaaaccggtaataatgagtctacaatatatatttcattataataagaaagatgcagtcagcttgcatgag |
103 |
Q |
| |
|
||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8726685 |
tgcaattccacagactaattgactatcgaaaaaaccggtaataatgagtctacaatatatatttcattataataagaaagatgcagtcagcttgcatgag |
8726586 |
T |
|
| Q |
104 |
tgcaaatccatgtgaattctggaaacttaatttgcctatcttataatggtgaaattcctaaaacaaacacatgcctagtggcagcacctgcggatcgtta |
203 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8726585 |
tgcaaatccatgtgaattctgaaaacttaatttgcctatcttataatggtgaaattcctaaaacaaacacatgcctagtggcagcacctacggatcgtta |
8726486 |
T |
|
| Q |
204 |
aacgtttctacggtccttatttgattatggaatggattggacaggttgcttacaaactggccttgcctcctgattccaaaattcatgatgt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8726485 |
aacgtttctacggtccttatttgattatggaacggattggacaggttgcttacaaactggccttgcctcctcattccaaaattcatgatgt |
8726395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University